Example of a fastq file in read 1 (in paired read sequencing) is as follows:

@SRR3117565.1.1 1 length=100
NCAAAACAGCTCTCCCTCCTTTGATCTGATGGTCTGCAGAGGTCCTCAAATCCACACACTGCCACTCTTCAAGACCAACCACTGGGCCTTCTTAATCTCA
+SRR3117565.1.1 1 length=100
#1=BDDDDHFHHAHDE?GFEEDHG@HFHEECDCGHE:FDFHD*?DHFD<GEDEGIIIIIA=AFFGACHDH>EHHF>;;B<;A;>=A=??@CCCC>5>>AC
@SRR3117565.2.1 2 length=100
NTCCTGACTCACACGCCACAACCATGACTGGCTCAGCTCCCTTAATTCCAGCTTCCCTTACATGACGCAATTCCTTCTCAGATTCGGGTTTTCAGCTGAG
+SRR3117565.2.1 2 length=100
#4BDFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJIHHFEFEEEEEEDDEDDDDDDDDBDDDDDDDDDDD


Example of a fastq file in read 2 is as follows:
@SRR3117565.1.2 1 length=100
TGGTTTTTTTTTTTGTCCCTCAAATTTTTGGACTCCGTAACATCAACCAGTTTGGAGTGGGATGACAGAGAGAATGCCCAATTTTGTGAGGCCCATGATT
+SRR3117565.1.2 1 length=100
59(2(3(2=9/>;?/=)))))().8<8))'-).6..8:(',)..)(((((-(53/(,,(((((,(((+(+(+2((((+((+((+23++(+2+++2++(((
@SRR3117565.2.2 2 length=100
CTGGCTTGTTATAACGCAAAGCTTGGTTGTTTATGCAACTCTATCTTAAGAACTGCCCAGCCTCAGCTGAAAACCCGAATCTGAGAAGGAATTGCGTCAT
+SRR3117565.2.2 2 length=100
CCCFFFFFHHHHHJJJJJJJJJJJJJIJJIJJJJJJJJJJJJJJJJJJJJJJJJIJJJJHIJJJHHHHHFFFFFDDDDDDDDEDDDDDDDDDDDDDDDDB
Following script fix it such that both fastq files (corresponding to the paired sequencing reads) of sample SRR3117565 have similar read names.
nohup sed 's/\([@|\+]SRR.*\)\.1.*/\1/' ./SRR3117565_1.fastq > ./SRR3117565_1.correctId.fastq &
nohup sed 's/\([@|\+]SRR.*\)\.2.*/\1/'./SRR3117565_2.fastq > ./SRR3117565_2.correctId.fastq &

Modify read names in bam files in Linux

In this example I would show how to remove ":1" and ":2" at the end of the query/read-names that show the first and the second paired read. If the reads/query names start with "SRR" the following scripts can be used:

samtools view ./file.bam | perl -pe 's/(^SRR.*?):[1-2]\t/\1\t/g' > ./file.sam
cat ./file.sam | samtools view -bS - > ./file_modified.bam

or all together the following script can be run:

samtools view ./file.bam | perl -pe 's/(^SRR.*?):[1-2]\t/\1\t/g' | samtools view -bS - > ./file_modified.bam

In the end the string modification may mix up the header of the bam files, as a solution to the problem the header could be seprataed the then reattached as following:
samtools view -H /netapp/seqRawData/eugeneMouse/DIV0.bam > /netapp/seqRawData/eugeneMouse/DIV0_head.sam &
samtools view /netapp/seqRawData/eugeneMouse/DIV0.bam | perl -pe 's/(^.*?):[1-2]\t/\1\t/g' > /netapp/seqRawData/eugeneMouse/DIV0M.sam &
cat /netapp/seqRawData/eugeneMouse/DIV0_head.sam /netapp/seqRawData/eugeneMouse/DIV0M.sam |samtools view -bS - > /netapp/seqRawData/eugeneMouse/DIV0M.bam

0

Add a comment

In this post I show how groupScatterPlot(), function of the rnatoolbox R package can be used for plotting the individual values in several groups together with their mean (or other statistics). I think this is a useful function for plotting grouped data when some groups (or all groups) have few data points ! You may be wondering why to include such function in the rnatoolbox package ?! Well ! I happen to use it quit a bit for plotting expression values of different groups of genes/transcripts in a sample or expression levels of a specific gene/transcript in several sample groups. These expression value are either FPKM, TPM, LCPM, or PSI values (Maybe I should go through these different normalizations later in a different post 😐!). But of course its application is not restricted to gene expression or RNAseq data analysis.

In this post I show how classifySex(), function of the rnatoolbox R package can be used for inferring the sex of  the studied subjects from their binary alignment bam files. The sex can be a source of unwanted variation within the data, for which you may want to adjust your differential gene expression or splicing analysis. However, complete  metadata are unfortunately not always available. Furthermore, sometimes details within metadata are incorrect or have been misplaced due to manual error. Therefore, it is a good practice to quickly double check some details within the data to either complete the missing metadata information or to make sure that the prior stages have been performed without any accidental mix-ups. For muscle tissues, this showed to be useful on our ribo-depleted RNAseq data. NOTE! Earlier the function referred to in this post was named differently(i.e. getGender). Since version 0.2.1 classifySex() is used.
2

Recently I have started to organize my commonly used functions related to quality assessment and analyzing RNAseq data into an R package. It is called rnatoolbox and it is available here. In this post I introduce getMappedReadsCount(), i.e. a function that can be used for checking the number of aligned/mapped fragments in several bam files and detecting the outliers. The outliers are the bam files with oddly high (i.e. exceeding1.5 times the interquartile) and oddly low (i.e. lower than 1.5 times the interquartile) number of mapped fragments.

The adhan package is available here !

The prayer times cannot always be estimated accurately in some places such as countries located in higher latitudes (e.g. the Nordic countries) . as for instance during midsummer time the Fajr may be impossible to estimate or in other words it may simply not exist ! Some Muslim residents of those countries follow Prayer times of other places such as Mecca and Medina.

Unsupervised machine learning methods such as hierarchical clustering allow us to discover the trends and patterns of similarity within the data. Here, I demonstrate by using a test data, how to apply the Hierarchical clustering on columns of a test data matrix. Note that as my main focus is Bioinformatics application, I assume that the columns of the matrix represent individual samples and the rows represent the genes or transcripts or some other biological feature.

Note ! the & sign is to run the command in background.

Getting MD5 sum for all files and writing it to a txt file in Linux.

md5sum * > myChecklist.txt &

Getting MD5 sum for all files and subfolders and writing it to a txt file in Linux.

find ./ -type f -exec md5sum {} + > myChecklist.txt &

Getting MD5 sum for all files and writing it to a txt file in Mac.

md5 -r * > myChecklist.txt &

Getting MD5 sum for all files and subfolders and writing it to a txt file in Mac.

Many times, in our projects, we may need to compare different measured factors in our samples to one another, and study whether they are linearly dependent. These information can also help us to detect covariates and factors that affect our studies but we would like to adjust for/remove their effects (more on this at sometime later). Here, I mention several functions that can be used to perform correlation tests. All of these functions do support both Pearson and ranked (Spearman) methods. Note that in the end of this post I will focus on these two different methods (i.e. Pearson vs Spearman) and show their differences in application.
2

Occasionally when indexing data frames the format is converted, leading to confusing consequences. As for instance, when indexing to select a single column the result is a 'numeric' or 'integer' vector. The following  demonstrates this :

When analyzing a data constructed of individuals (or samples from individuals) of both male and female of a species (e.g. humans), often it is a good idea to compare the distribution of the various studied parameters for the males to those for the females. As for instance in RNAseq analysis, it is the measured expression of many genes may differ significantly between the studied males and females. In other words the gender may exhibit 'batch effect' in the gene expression data.

Here is an example of plotting 4 venn diagrams in a single screen with a 2*2 layout.

library(VennDiagram)

#defining vectors

av<- 1:10

bv<- 12:20

cv<-  7:15

# Building venndiagram grid objects (i.e.
1
Labels
Blog Archive
About Me
About Me
My Photo
I am a Postdoc researcher at the Neuromuscular Disorders Research lab and Genetic Determinants of Osteoporosis Research lab, in University of Helsinki and Folkhälsan RC. I specialize in Bioinformatics. I am interested in Machine learning and multi-omics data analysis. My go-to programming language is R.
My Blog List
My Blog List
Loading
Dynamic Views theme. Powered by Blogger. Report Abuse.