Example of a fastq file in read 1 (in paired read sequencing) is as follows:

@SRR3117565.1.1 1 length=100

NCAAAACAGCTCTCCCTCCTTTGATCTGATGGTCTGCAGAGGTCCTCAAATCCACACACTGCCACTCTTCAAGACCAACCACTGGGCCTTCTTAATCTCA
+SRR3117565.1.1 1 length=100
#1=BDDDDHFHHAHDE?GFEEDHG@HFHEECDCGHE:FDFHD*?DHFD<GEDEGIIIIIA=AFFGACHDH>EHHF>;;B<;A;>=A=??@CCCC>5>>AC
@SRR3117565.2.1 2 length=100
NTCCTGACTCACACGCCACAACCATGACTGGCTCAGCTCCCTTAATTCCAGCTTCCCTTACATGACGCAATTCCTTCTCAGATTCGGGTTTTCAGCTGAG
+SRR3117565.2.1 2 length=100
#4BDFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJIHHFEFEEEEEEDDEDDDDDDDDBDDDDDDDDDDD

Example of a fastq file in read 2 is as follows:

@SRR3117565.1.2 1 length=100
TGGTTTTTTTTTTTGTCCCTCAAATTTTTGGACTCCGTAACATCAACCAGTTTGGAGTGGGATGACAGAGAGAATGCCCAATTTTGTGAGGCCCATGATT
+SRR3117565.1.2 1 length=100
59(2(3(2=9/>;?/=)))))().8<8))'-).6..8:(',)..)(((((-(53/(,,(((((,(((+(+(+2((((+((+((+23++(+2+++2++(((
@SRR3117565.2.2 2 length=100
CTGGCTTGTTATAACGCAAAGCTTGGTTGTTTATGCAACTCTATCTTAAGAACTGCCCAGCCTCAGCTGAAAACCCGAATCTGAGAAGGAATTGCGTCAT
+SRR3117565.2.2 2 length=100
CCCFFFFFHHHHHJJJJJJJJJJJJJIJJIJJJJJJJJJJJJJJJJJJJJJJJJIJJJJHIJJJHHHHHFFFFFDDDDDDDDEDDDDDDDDDDDDDDDDB

Following script fix it such that both fastq files (corresponding to the paired sequencing reads) of sample SRR3117565 have similar read names.

Modify read names in bam files in Linux

In this example I would show how to remove ":1" and ":2" at the end of the query/read-names that show the first and the second paired read. If the reads/query names start with "SRR" the following scripts can be used:


or all together the following script can be run:


In the end the string modification may mix up the header of the bam files, as a solution to the problem the header could be seprataed the then reattached as following: