Many times, in our projects, we may need to compare different measured factors in our samples to one another, and study whether they are linearly dependent. These information can also help us to detect covariates and factors that affect our studies but we would like to adjust for/remove their effects (more on this at sometime later). Here, I mention several functions that can be used to perform correlation tests. All of these functions do support both Pearson and ranked (Spearman) methods. Note that in the end of this post I will focus on these two different methods (i.e. Pearson vs Spearman) and show their differences in application.

First, let's construct a 10×5 matrix and replace 10 randomly picked positions within the matrix with NAs (i.e. missing values).


# Make test data matrix
dat<- matrix(rnorm(50), nrow=10, ncol=5)

# JUST R VALUES NO P !
# Replace 10 NAs within matrix randomly

set.seed (877)
naInd<- sample(1:length(dat), 10)
dat[naInd]<- NA
colnames(dat)<- paste("col", 1:ncol(dat), sep="")
rownames(dat)<- paste("row", 1:nrow(dat), sep="")
dat
#             col1       col2       col3       col4        col5
# row1  -0.8882978 -1.3064945 -0.8559183 -1.2621139  0.28889517
# row2  -1.1934817         NA  1.0021094  0.2707312  2.65574584
# row3   0.5436480 -0.9709940         NA -2.0137933 -0.03901379
# row4  -0.1557453 -1.6251252 -0.2549788 -0.5652703          NA
# row5  -0.7226121  2.7137291 -0.5804944  0.4200483 -0.18883746
# row6          NA -0.9527775  2.1885032 -0.3665413  1.14035680
# row7          NA  1.4430923         NA  0.3362986          NA
# row8   0.4691104 -1.5502340         NA         NA  0.22606033
# row9  -0.3557879  0.1540679 -0.4542577  0.4951978 -1.11224029
# row10  0.6162009         NA -0.9514461 -1.0438710 -1.48530042

Normally, we can use the cor() function from the stats package to get pairwise correlations over the columns of a data frame such as dat. However, as demonstrated in the following, due to the NAs in the data frame the results of the correlations will be mainly NA. Note, that parameter settings such as na.rm=TURE (that ignores the NAs in functions such as median and mean) are not supported by the cor() function. Furthermore, the cor() function does not run statistical tests, hence it does not return p values for the comparisons (execute ?cor for more info).

cor(dat)
#      col1 col2 col3 col4 col5
# col1    1   NA   NA   NA   NA
# col2   NA    1   NA   NA   NA
# col3   NA   NA    1   NA   NA
# col4   NA   NA   NA    1   NA
# col5   NA   NA   NA   NA    1


One may be tempted to remove those rows from the data frame that have one or more missing values. However, you may be left with too small number of rows in your data to run any meaningful correlation analysis.

#Removing rows with NAs
as.data.frame(na.omit(dat))

#            col1       col2       col3       col4       col5
# row1 -0.5903153  1.1200880 -1.4642429  0.2085692  1.1770598
# row5  0.4496017  0.8385497 -0.4793778 -0.1731461  0.8716287
# row9 -0.5647845 -1.6658176 -0.5613469  0.7549264 -1.1794651

#Running correlation on NA filtered data
cor(na.omit(dat))

#            col1       col2       col3       col4       col5
# col1  1.0000000  0.1517447  0.9106435  0.7645283 -0.9994524
# col2  0.1517447  1.0000000  0.5465933  0.7531387 -0.1843677
# col3  0.9106435  0.5465933  1.0000000  0.9625528 -0.9238171
# col4  0.7645283  0.7531387  0.9625528  1.0000000 -0.7854387
# col5 -0.9994524 -0.1843677 -0.9238171 -0.7854387  1.0000000

We would, of course, prefer to get the most from our data. Therefore, we would like to ignore the NAs in each paired correlation test. One correlation function supported by R's stats package that can remove the NAs is cor.test() . However, this function only runs correlation on a pair of vectors and does NOT accept a data.frame/matrix as its input (to run correlation on the columns of the data frame and build a a pairwise correlation matrix accordingly). Note that the cor.test() function also returns measured p values for the comparisons. Here, we define a mycor() function that adapts cor.test to run pairwise correlations over all columns of an input data frame and returns two matrices for the r values and p values of the pairwise comparisons.

# Returns r and p values but does not accept data frame as input !
cor.test(dat[,1], dat[,2], na.action=na.omit)
# Pearson's product-moment correlation
#
# data:  dat[, 1] and dat[, 2]
# t = -1.063, df = 4, p-value = 0.3477
# alternative hypothesis: true correlation is not equal to 0
# 95 percent confidence interval:
#  -0.9275857  0.5527702
# sample estimates:
#        cor
# -0.4693404

# Defining a correlation function that suits a data frame input
# and returns r and p values
mycor<- function(x,...){
  r<- apply(x, 2, function(j){
    apply(x, 2, function(i){
      as.numeric(cor.test(i,j, ...)$estimate)
    })
  })
  P<- apply(x, 2, function(j){
    apply(x, 2, function(i){
      as.numeric(cor.test(i,j, ...)$p.value)
    })
  })
  out<-c()
  out$P<- P
  out$r<- r
  return(out) 
}

# Running the defined correlation function and measuring
# its running time
time1<- Sys.time()
myCorDat<- mycor(dat, method="pearson", na.action=na.omit)
time2<- Sys.time()


(runTimeMyCor<- difftime(time2,time1))

#Time difference of 0.02293086 secs


One problem with using cor.test in a loop or apply function is that it is inefficient (or in other words slow), especially for a large data. This problem can also be seen in the mycor() function mentioned above, as it takes ~0.02 seconds on my system to run on a data of size 50 (i.e. 10×5 matrix). If you are willing to install the Hmisc R package (available in CRAN), it supports an rcorr() function which: is robust, accepts a numeric matrix (or 2 numeric matrics !) as input, removes NAs according to the pairwise comparisons, and returns measured r and p values for the pairwise comparisons.

#Running rcorr function and measuring run time
ime1<- Sys.time()
rcorrDat<- Hmisc::rcorr(dat, type="pearson")
time2<- Sys.time()
(runTimeRcorr<- difftime(time2,time1))
#Time difference of 0.0009348392 secs

#mycor vs rcorr run time
c(runTimeMyCor, runTimeRcorr)
# Time differences in secs
# [1] 0.0229308605 0.0009348392

rcorrDat
#       col1  col2  col3  col4  col5
# col1  1.00 -0.47 -0.59 -0.61 -0.60
# col2 -0.47  1.00 -0.25  0.69 -0.40
# col3 -0.59 -0.25  1.00  0.25  0.71
# col4 -0.61  0.69  0.25  1.00  0.19
# col5 -0.60 -0.40  0.71  0.19  1.00
#
# n
#      col1 col2 col3 col4 col5
# col1    8    6    6    7    7
# col2    6    8    5    7    6
# col3    6    5    7    7    6
# col4    7    7    7    9    7
# col5    7    6    6    7    8
#
# P
#        col1   col2   col3   col4   col5 
# col1        0.3477 0.2166 0.1428 0.1506
# col2 0.3477        0.6842 0.0854 0.4283
# col3 0.2166 0.6842        0.5851 0.1115
# col4 0.1428 0.0854 0.5851        0.6782
# col5 0.1506 0.4283 0.1115 0.6782      



 

Correlation plotting

One interesting plotting method is corrplot() that provided by the corrplot R package. This function mainly visualizes the r measurements for the paired correlations. The size and colour of circles in the figure represent the r. If the p value is higher than the defined sig.level threshold parameter,  an X sign shows that the correlation is NOT significant.

library(corrplot)
jpeg("corplotTest.jpg", width=800, height=800, quality=100, pointsize=24)
corrplot(corr=myCorDat$r,
         p.mat = myCorDat$P,
         type="full", insig="pch", sig.level =.1, pch.cex = .9)
dev.off()


The default colour palette is not too popular in our lab though! We prefer to use as warm (e.g. red) colour for the higher values and cold (e.g. blue) colour for the lower values. Using the following code I usually build a custom colour palette function that is in the reverse order as the default colours used by corrplot.

# make function that makes set colors
col2 <- colorRampPalette(c("#053061", "#2166AC", "#4393C3",
                           "#92C5DE", "#D1E5F0", "#FFFFFF",
                           "#FDDBC7", "#F4A582", "#D6604D",
                           "#B2182B", "#67001F"))

jpeg("corplotTest2.jpg", width=800, height=800, quality=100, pointsize=24)
corrplot(corr=myCorDat$r,
         p.mat = myCorDat$P,
         type="full", insig="pch", sig.level =.1, pch.cex = .9, col=col3(200))
dev.off()


Since we have randomly generated the values in our test data, the moderately high and significant correlation of col4 with col2 may come as a surprise! First of all, note that its pvalue is actually ~0.085 which is not really less than 0.05. We actually chose a more relaxed 0.1 pvalue significance threshold in the plot. Nevertheless, this shows that as the number of comparisons increases (in relation to the size of data), the chances of acheiving an accidental signifcant correlation increases. Pvalue adjustments can be helpful to correct for multiple testing. In the following we first recheck the correlation of col4 vs col2. Next, we adjust the pvalues acheived by the correlation tests using Benjamini and Hochberg method. Finally, we plot col4 vs col2 abd fit a line to the data points in the plot. Note that since the pairwise correlation matrices are symmetric and the diagonals are predictable (since it is the result of correlation of every column with itself !), I will run the p adjustment over the lower triangular of the P value matrix. As you can see the adjusted p values are no longer significant !

# Recheck correlation of col4 vs col2
cor.test(x=dat[,"col2"], y=dat[,"col4"], method="pearson")

#
# Pearson's product-moment correlation
#
# data:  dat[, "col2"] and dat[, "col4"]
# t = 2.1394, df = 5, p-value = 0.08538
# alternative hypothesis: true correlation is not equal to 0
# 95 percent confidence interval:
#  -0.1287915  0.9498704
# sample estimates:
#       cor
# 0.6913155

p.adjust(myCorDat$P[lower.tri(myCorDat$P, diag = FALSE)], method="BH")
# [1] 0.9401500 0.8955621 0.9401500 0.9401500 0.9401500 0.6116986
# [7] 0.6116986 0.7738987 0.6116986 0.9401500

# Plot col4 (y-axis) vs col2 (x-axis)
jpeg("highCorPlot.jpg", width=800, height=800, quality=100, pointsize=24)
plot(dat[,"col2"], dat[,"col4"], pch=16, xlab="col2", ylab="col4")
abline(lm(dat[,"col4"]~dat[,"col2"]), col="red", lwd=2)
dev.off()


Pearson vs Spearman correlation

All the codes above use Pearson; i.e. default method used in most correlation related functions. Many of these functions do however support Spearman (i.e. ranked correlation measurement method) as well well. As demostrated by a simple exponential test data, Spearman correlation is more forgiving towards skewness and extreme outliers and manages to detect the strong correlation between the defined x and y in the following scripts.

# Defining an unskewed data
x<- 1:50
# Defining a highly skewed data
y<-exp(x)

e1071::skewness(x)
#[1] 0
e1071::skewness(y)
#[1] 5.574573

cor.test(x=x, y=y, method="pearson")
#
# Pearson's product-moment correlation
#
# data:  x and y
# t = 2.6098, df = 48, p-value = 0.01205
# alternative hypothesis: true correlation is not equal to 0
# 95 percent confidence interval:
#  0.08223784 0.57449344
# sample estimates:
#       cor
# 0.3525162 

cor.test(x=x, y=y, method="spearman")
#
# Spearman's rank correlation rho
#
# data:  x and y
# S = 0, p-value < 2.2e-16
# alternative hypothesis: true rho is not equal to 0
# sample estimates:
# rho
#   1

jpeg("whySpearman.jpg", width=800, height=800, quality=100, pointsize=24)
plot(x, y, pch=16, xlab="x", ylab="y = exp(x)")
dev.off()

2

View comments

In this post I show how groupScatterPlot(), function of the rnatoolbox R package can be used for plotting the individual values in several groups together with their mean (or other statistics). I think this is a useful function for plotting grouped data when some groups (or all groups) have few data points ! You may be wondering why to include such function in the rnatoolbox package ?! Well ! I happen to use it quit a bit for plotting expression values of different groups of genes/transcripts in a sample or expression levels of a specific gene/transcript in several sample groups. These expression value are either FPKM, TPM, LCPM, or PSI values (Maybe I should go through these different normalizations later in a different post 😐!). But of course its application is not restricted to gene expression or RNAseq data analysis.

In this post I show how classifySex(), function of the rnatoolbox R package can be used for inferring the sex of  the studied subjects from their binary alignment bam files. The sex can be a source of unwanted variation within the data, for which you may want to adjust your differential gene expression or splicing analysis. However, complete  metadata are unfortunately not always available. Furthermore, sometimes details within metadata are incorrect or have been misplaced due to manual error. Therefore, it is a good practice to quickly double check some details within the data to either complete the missing metadata information or to make sure that the prior stages have been performed without any accidental mix-ups. For muscle tissues, this showed to be useful on our ribo-depleted RNAseq data. NOTE! Earlier the function referred to in this post was named differently(i.e. getGender). Since version 0.2.1 classifySex() is used.

2

Recently I have started to organize my commonly used functions related to quality assessment and analyzing RNAseq data into an R package. It is called rnatoolbox and it is available here. In this post I introduce getMappedReadsCount(), i.e. a function that can be used for checking the number of aligned/mapped fragments in several bam files and detecting the outliers. The outliers are the bam files with oddly high (i.e. exceeding1.5 times the interquartile) and oddly low (i.e. lower than 1.5 times the interquartile) number of mapped fragments.

The adhan package is available here !

The prayer times cannot always be estimated accurately in some places such as countries located in higher latitudes (e.g. the Nordic countries) .

Unsupervised machine learning methods such as hierarchical clustering allow us to discover the trends and patterns of similarity within the data. Here, I demonstrate by using a test data, how to apply the Hierarchical clustering on columns of a test data matrix.

Note ! the & sign is to run the command in background.

Getting MD5 sum for all files and writing it to a txt file in Linux.

md5sum * > myChecklist.txt &

Getting MD5 sum for all files and subfolders and writing it to a txt file in Linux.

Many times, in our projects, we may need to compare different measured factors in our samples to one another, and study whether they are linearly dependent. These information can also help us to detect covariates and factors that affect our studies but we would like to adjust for/remove their effects (more on this at sometime later). Here, I mention several functions that can be used to perform correlation tests. All of these functions do support both Pearson and ranked (Spearman) methods. Note that in the end of this post I will focus on these two different methods (i.e. Pearson vs Spearman) and show their differences in application.

2

Occasionally when indexing data frames the format is converted, leading to confusing consequences. As for instance, when indexing to select a single column the result is a 'numeric' or 'integer' vector. The following  demonstrates this :

When analyzing a data constructed of individuals (or samples from individuals) of both male and female of a species (e.g. humans), often it is a good idea to compare the distribution of the various studied parameters for the males to those for the females.

Here is an example of plotting 4 venn diagrams in a single screen with a 2*2 layout.

library(VennDiagram)

#defining vectors

av<- 1:10

bv<- 12:20

cv<-  7:15

# Building venndiagram grid objects (i.e.

1

Planning to draw a density line-plot with gapped (or broken) Y-axis in R, I initially tried out the plotrix package (version 3.8.1). However after facing a couple of problems, I ended up using the standard R graphics codes to draw the correct gapped line-plot.

In January 2018 our lab purchased a modest but good enough espresso machine and coffee grinder. The following table shows the coffee beans that we have used so far to make espresso in our lab.

Many times in my career I have needed to merge several PDF files into a single PDF file. As for instance, the most common format of the PhD thesis in our department is that it begins with a comprehensive review (referred to as 'review of the literature') and continues with several published papers.

1

Ali Oghabian

2019-04-25

The topics covered in this post are:

R and IntEREst version Files in the zip Annotating u12 type introns of HG38 ncRNAs with U12-type introns U12 annotation comparison Reference Files in the zip

You can download the zip file the includes all the scripts and R objects from

Example of a fastq file in read 1 (in paired read sequencing) is as follows: @SRR3117565.1.1 1 length=100 NCAAAACAGCTCTCCCTCCTTTGATCTGATGGTCTGCAGAGGTCCTCAAATCCACACACTGCCACTCTTCAAGACCAACCACTGGGCCTTCTTAATCTCA +SRR3117565.1.1 1 length=100 #1=BDDDDHFHHAHDE?GFEEDHG@HFHEECDCGHE:FDFHD*?DHFDEHHF>;;B<;A;>=A=??@CCCC>5>>AC @SRR3117565.2.1 2 length=100 NTCCTGACTCACACGCCACAACCATGACTGGCTCAGCTCCCTTAATTCCAGCTTCCCTTACATGACGCAATTCCTTCTCAGATTCGGGTTTTCAGCTGAG +SRR3117565.2.1 2 length=100 #4BDFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJIHHFEFEEEEEEDDEDDDDDDDDBDDDDDDDDDDD

The steps I take to analyse RNA-seq data in the lab are :

Checking mapping qualities, e.g. running fastQC on fastq files. Check the fastQ files to see if any reads cotain the primer (adapter sequence). See Note 3 ↓. This could also be seen in the fastQC (quality checking) results (see fig 1 & 2).

Sometimes painstaking text modifications specially when one is dealing with large data could easily be solved using few lines of scripts of a programming language.

Yesterday (on the opening day of the new Batman movie) I search the Internet for the Batman formula and it's implementations in R. I found several links that used the ggplot2 library however only one was working with the latest version of the package. With minor changes, this is the result that I got for the Batman curve.

I just needed to come up with a name for my blog, so as most of the times, when I'm working in the lab I got some help from my favourite programming language, R. See if you could find a better name with playing a round with the seedNumber, and nameSize parameters.

Loading